Overblog
Suivre ce blog
Administration Créer mon blog
30 septembre 2009 3 30 /09 /septembre /2009 23:59

مفهوم المورثة و الحليل:

نفس الصفة الوراثية تأخذ عدة مظاهر خارجية مما يدل على أن المحتوى الوراثي المحدد لهذه الصفة يخضع لتغيرات بفعل الطفرات.
مثال لون البدور عند الجليان petit pois
مظهر خارجي أخضر مظهر خارجي أصفر لاحظ أن الأخضر و الأصفر يعبران على مظهرين مختلفين لنفس الصفة(اللون )
الجزء المسؤول عن اللون على مستوى ADN ادن يختلف محتواه الوراثي عند النبتتين : يشكل هذا المحتوى الحليل Allèle
المورثة: ادن عبارة عن جزء من ADN يرمز إلى صفة وراثية(اللون مثلا) والحليل عبارة عن المحتوى الوراثي لهذا الجزء ويرمز إلى مظهر خارجي معين
( الأخضر أو الأصفر مثلا ) يمكن المرور من حليل لأخر بفعل حدوث تغير فجائي ينعت بالطفرة.
مفهوم المظهر الخارجي :
مثال: فقر الدم المنجلي : مرض وراثي يتميز باتخاذ الكريات الحمراء شكل منجلي عند الشخص المصاب.
فما هو سبب هذا الشكل مقارنة مع الشكل العادي للكريات الحمراء - لفهم سبب اختلاف شكل الكريات الحمراء عند الشخصين نقوم بمقارنة محتوى هاذين الصنفين من الخلايا ( مع التذكير بأن محتوى الكريات الحمراء يتجلى في الخضاب الدموي وهو بروتين صنف الكريونات )
البروتين = سلسلة من الأحماض الأمينية (أنظر مقرر الأولى باك)


لنقارن ادن الخضاب الدموي الموجود بداخل الكريات الحمراء المنجلية(HbS) بالخضاب الدموي للكريات ذات الشكل العادي(HbA):
Val- His- Leu- Thr- Pro- Glu- Lys حالة الشخص السليم.
Val- His- Leu- Thr- Pro- Val- Lys حالة الشخص المصاب
سنقتصر على تمثيل جزء من السلسلة B وهو الجزء المميز للحالتين ( الأجزاء الغير ممثلة لم يعاين أي اختلاف بين الشخصين السليم والمصاب.) لاحظ أن الحمض ألأميني رقم 6 في السلسلة العادية هو Glucine وفي السلسلة الغير عادية هو Valine مما يعني أن سبب الاختلاف يتجلى في استبدال حمض أميني بأخر. هذا الاستبدال يجعل جزيئات الخضاب نوع HbS تلتصق فيما بينها بعد تحريرها للأكسجين مما يفقدها خصائصها الأصلية(حالة مذابة) هذا التصلب يغير في شكل الكريات الحمراء لتصبح منجلية. أنقر هنا لملاحظة خصائص HbS
ما هي عواقب هذا التغير بالنسبة لخصائص الخضاب الدموي؟
قدرة الكريات الحمراء على نقل الأكسجين مرتبطة بسهولة حركتها .بسبب التصاق جزيئات الخضاب الدموي فيما بينها تتخذ الكريات الحمراء شكل منجلي مما يجعل قدرتها على نقل الأكسجين ضعيفة بفعل حركتها الصعبة داخل العروق. أنقر لتتبع عواقب ذلك
استنتاج : سبب فقر الدم ادن خلل في بروتين الكريات الحمراء مما يعني أن المظهر الخارجي على مستوى الجزيئي عبارة عن 17
فما هو سبب استبدال Glu ب Val في السلسلة الغير عادية؟
لنقارن جزء ADN المناسب عند الشخصين:
جزء ADN عند الشخص السليم: CACGTGGAATGAGGTCTCCTC
GTGCACCTTACTCCAGAGGAG
نفس الجزء عند الشخص المصاب:
CACGTGGAATGAGGTCACCTC
GTGCACCTTACTCCAGTGGAG

لاحظ أن النكليوتيد رقم 17 T استبدل ب A مما نتج عنه استبدال Glucine ب Valine على مستوى السلسلة B للخضاب الدموي HbS
استنتاج : تسلسل النكليوتيدات ادن على مستوى ADN يرمز إلى تسلسل الأحماض الأمينية على مستوى البروتين: هناك ادن رمز وراثي
خلاصة عامة:
عمل المورثة يقتصر في التحكم في تسلسل الأحماض الأمينية على مستوى البروتينات المنتجة من طرف الخلايا.آلية تعبير الخبر الوراثي يتجلى ادن في آلية تركيب البروتينات.
تركيب البروتينات:
المورثة توجد داخل النواة وعملية تركيب البروتين تتم في السيتوبلازم :التواصل بين النواة والسيتوبلازم يتم عن طريق ARNm- تتم العملية ادن عبر مرحلتين –
  1. الاستنساخ: تشكل ARNm انطلاقا من أحد شريطي ADN.





    ARNm المحصل عليه
    AACCCGAUUGUGCAGUC 3' 5'
  2. الترجمة : تتم في السيتوبلازم بفضل الجسيمات الريبية حيث تترجم كل وحدة رمزية إلى حمض أميني محدد :يشمل الرمز الوراثي على 64 وحدة رمزية ترمز إلى 20 حمض أميني مختلف مما يعطي لكل حمض أكثر من وحدة رمزية مناسبة :يتميز الرمز بالتكرار.3 وحدات ليس لها معنى تعرف بوحدات قف Stop على اعتبار أنها سبب توقف عملية الترجمة.
    يمكنك اكتشاف مضمون الرمز الوراثي هنا أنقر المبدأ: أكتب الوحدة الرمزية في المكان المناسب ثم أضغط على OK
    مثال: UUUAUAAAACCGCGU 3' 5' ARNm
    بعد الترجمة نحصل على السلسلة الببتيدية التالية
    Phe – Ile – Lys – Pro - Arg



أنقر لتتبع آلية تعبير الخبر الوراثي
يمكنك ملاحظة العلاقة :بروتين- ARNm ADN-

عن وقع ويب كور

Published by دفاتر الاختلاف الالكترونية - dans مدارات علوم الحياة والأرض
commenter cet article
30 septembre 2009 3 30 /09 /septembre /2009 23:53
نقل الخبر الوراثي أثناء الانقسام غير المباشر

الأهداف المعرفية:
تعرف مراحل الانقسام غير المباشر عند كل من الخلية النباتية والخلية الحيوانية.
فهم دور الصبغيات في نقل الخبر الوراثي من الخلية الأم إلى الخلية البنت.
فهم المميزات الوراثية للانقسام غير المباشر.
الانقسام غير المباشر عند الخلية النباتية:
إليك صور ملاحظة بالمجهر لخلية جدر البصل خلال مختلف مراحل الانقسام غير المباشر: حاول أن تستنتج أهم التغيرات الحاصلة على مستوى نواة الخلية ورتب الصور حسب تسلسلها الزمني
.

لاحظ أن أهم التغيرات تخص النواة : اختفاء النويات والغشاء النووي ثم اتخاذ النواة لمظهر خييطي : الصبغيات (خييطات تظهر في النواة أثناء الانقسام)
مراحل الانقسام غير المباشر
الصورة b: لاحظ أن حدود النواة واضحة وبها نويات المادة النووية التي تظهر قاتمة عبارة عن الصبغين:الخلية هنا في طور السكون (لم تشرع بعد في الانقسام)
الصورة c : لاحظ تغير مظهر النواة أصبح خييطي وحدودها تلاشت(اختفاء النويات والغشاء النووي) الخييطات عبارة عن الصبغيات. Chromosomes:المرحلة التمهيدية من الانقسام.
الصور d.fوg: لاحظ وضوح الصبغيات وتموضعها على شكل صفيحة استوائية :الخلية هنا في الطور الاستوائي من الانقسام .
الصور h وa: لاحظ انفصال مجموعتين من الصبغيات و تصاعد قطبي لكل مجموعة :الخلية هنا في الطور الانفصالي من الانقسام.
الصورة e: لاحظ تشكل نواتين جديدتين في قطبي الخلية الأم انطلاقا من الصبغيات الأصلية ثم ظهور جدار جديد يفصل السيتوبلازم الأصلي إلى جزئين نحصل بذلك على خليتين بنتين:الطور النهائي.
خلاصة

يتم الانقسام عبر مراحل متسلسلة: التمهيدية-الاستوائية – الانفصالية ثم النهائية. أهم ما يميز المراحل الثلاث الأولى :ظهور الصبغيات تموضعها على شكل
صفيحة استوائية ثم انفصالها إلى مجموعتين (انقسام النواة إلى نواتين) المرحلة النهائية تتميز بانقسام السيتوبلازم لنحصل في النهاية على خليتين.
حالة الخلية الحيوانية: تظهر الوثيقة التالية رسوم تفسيرية لمراحل الانقسام غير المباشر عند الخلية الحيوانية.

لاحظ أن الخلية الحيوانية تتميز بوجود جسيم مركزي الذي يشكل مصدر النجيمتان خلال الطور التمهيدي من الانقسام.
غياب الجدار الهيكلي يجعل انقسام السيتوبلازم عملية سهلة وتتم بواسطة الاختناق الاستوائي.
بالنسبة لتسلسل أحداث الانقسام تتم وفق نفس المراحل المشار إليها سابقا.
لاحظ أن صبغيات الخلية الأم ناقلة للخبر الوراثي إلى الخلايا البنات فهي ادن تشكل دعامة الخبر الوراثي
مفهوم الخريطة والصيغة الصبغيتين:

الخريطة تعبر عن صبغيات الخلية مرتبة من الأكبر إلى الأصغر :
لاحظ أن صبغيات الخريطة'' ب'' مرتبة على شكل أزواج أي أن لكل صبغي مماثله نقول أن الخلية هنا ثنائية الصيغة الصبغية ونرمز لها ب 2n هنا 2n=46
لاحظ أن صبغيات الخريطة ''أ'' مرتبة على شكل أفراد أي أن كل صبغي ممثل بنمودج واحد :الخلية هنا أحادية الصيغة الصبغية نرمز لها ب n هنا
ما هي العلاقة بين الصبغيات وADN؟
خلال طور السكون تظهر الصبغيات على شكل عقود من اللؤلؤ كل عقد مكون من ADN وبروتينات تنعت بالهستونات
مع بداية الانقسام تتكدس الخييطات لتصبح الصبغيات واضحة خلال فترات الانقسام حيث يصبح التكدس في أوجه خلال الطور الاستوائي.

1:مظهر خييطات الصبغين خلال طور السكون
2:أنظر البنية الجزيئية لمادة ADN
3
:مظهر الصبغي خلال فترة الانقسام
كيف تتطور كمية ADN خلال الدورة الخلوية؟

الدورة الخلوية تعبر عن المدة الفاصلة بين انقسامين متتاليين وتشمل طور السكون(G2-S-G1) وفترة انقسام(M)


لاحظ أن كمية ADN عند الخلية البنت هي نفس الكمية عند الخلية الأم بفضل التضاعف الملاحظ خلال المرحلة S من طور السكون.
فما هي آلية تضاعف ADN وما هي خاصية هذا النمط من التوالد؟ للإجابة على هذا السؤال نقترح نتائج تجارب Stahl و Messelson


تفسير النتائج

ADN الوسط الأول ثقيل لأن ألأزوت المدمج في كلا الشريطين من النوع الثقيل N15.
ADN الخلايا الناتجة عن انقسام الأولى في الوسط الثاني من النوع الهجين أي وسيط بين الخفيف و الثقيل مما يعني أنه تم دمج أزوت خفيف الى جنب الأزوت الأصلي الثقيل.
ADN المحصل عليه بعد الانقسام الثاني في نفس الوسط نوعان نوع خفيف ونوع هجين مما يعني أنه أثناء تضاعف ADN يحافظ دائما على جزء أصلي وتتم بلمرة جزء جديد: تنعث الالية بالنصف محافضة .لفهم أكثر اليك عزيزي الرسوم المفسرة لالية النسخ النصف المحافظ.

الشريط الأصلي يلعب دور القالب أثناء عمل أنزيم البلمرة (ADN polymérase) مما يجعل ADN المحصل عليه مطابق للأصلي.أثناء المرحلة الانفصالية من الانقسام الخلوي كلا الخليتين البنتين تحصل ليس فقط على نفس كمية ADN الخلية الأم (بفضل التضاعف) لكن كذلك على نفس نوع ADN بفضل الآلية النصف المحافظة :يحافظ على نفس الخبر الوراثي إذن من الخلية الأم إلى الخلية البنت فالانقسام الخلوي توالد مطابق للأصل( التلميم

Clonage
).

عن وقع ويب كور
Published by دفاتر الاختلاف الالكترونية - dans مدارات علوم الحياة والأرض
commenter cet article
30 septembre 2009 3 30 /09 /septembre /2009 23:41

 

قد تتساءل لماذا نبحث عن الخبر الوراثي على مستوى الخلية : حاول أن تعتمد المنطق التالي:
تعلم أن الحياة مجموعة وظائف حيوية وأن هذه الوظائف وراثية وأن كل ما هو وراثي مصدره الخبر الوراثي ادن فهذا الأخير يشكل دعامة الحياة
تعلم أن الخلية هي المسيطرة على الوظائف وبالتالي فالخبر الوراثي يتموضع في الخلية . فأين يتموضع داخل الخلية ؟
للإجابة على هذا السؤال حاول أن تفسر نتائج تجربة التقطيع المنجزة عند Acetabularia
عبارة عن طحلب أخظر وحيد الخلية يعيش متبث فوق الصخور : نقتصر هنا على النوعين A.m و A.c
أنقر لملاحظة نمو الطحلب
أنقر لملاحظة نتائج تجربة التقطيع

تجربة1: فصل الطحلب إلى جزئين: الجزء القاعدي به نواة والجزء العلوي بدون نواة
.تفسير نتائج التجربة:
ضمور الجزء العلوي يفسر بعدم توفره على المادة الوراثية نمو الجزء القاعدي وتعويضه لقبعة جديدة يفسر بتوفره على المادة الوراثية
تجارب اظافية:أنقر هنا
تجربة2:

لا حظ أن الجزء القاعدي ينمو ويجدد قبعة بمواصفات النوع المعطي للنواة مما يدل على أن شكل القبعة يتحدد من خلال
معلومات وراثية متمو ضعة في نواة الخلية
استنتاج :المادة الوراثية متمو ضعة داخل نواة الخلية
ما هي طبيعة المادة الوراثية؟
نعلم الأن أن الخبر الوراثي يوجد في النواة : النواة تتحكم في الوظائف التي تتم على مستوى الجبلة الشفافة
(سنحاول فيما بعد معرفة كيف يتم التواصل بين النواة والسيتوبلازم ) فما هي الطبيعة الكيميائية للمادة الوراثية؟
حاول أن تجد تفسير لنتائج تجارب Griffith. أنقر لملاحظة نتائج تجارب Griffith
قام بحقن مجموعات من الفئران بنوعين من المكورات الثنائية الرئوية(بكتيريات) حسب الظروف التجريبية الممثلة أسفله.

تجارب Griffith


لاحظ ان المكورات الثنائية الرئوية نوع S تسببت في موت الفئران فهي ادن مميتة( حادة) عكس النوع R لم تتأثر به الفئران فهو ادن غير حاد

بإيجادك لتفسير مقنع لنتائج التجربة الثالثة ل Griffith ستلاحظ أن R تحول إلى S : هذا التحول ليس تلقائي بل هناك علة محولة وهي جزء من الخبر الوراثي للنوع S بحيث اكتساب النوع Rلصفة النوع S( العلبة ) سببه اكتساب جزء من مادته الوراثية والموجودة
ضمن بقايا S .البحث عن العلة المحولة هو البحث عن المادة الوراثية. فما طبيعتها ؟
تجارب Avery والمجموعة: أنقر لملاحظة بنية الخلية البكتيرية
تذكير: بقايا البكتيرية S تتكون من دهنيات - بروتيدات - ونوعين من الأحماض الأزوتية : ARN و ADN
تمت معالجة بقايا S بمختلف أنزيمات هضمية بهدف التخلص من مختلف المواد المكونة للبكتيرية قبل حقنها مع محلول به النوع R لمجموعة من الفئران
لاحظ أن العلة المحولة تختفي فقط في حالة غياب ADN مما يعني أن هذه المادة تشكل العلة المحولة.
لاحظ أن العلة المحولة تختفي بعد معالجة بقايا S بالأنزيم الهاضم لمادة ADN أي أن سبب اكتساب النوع R للعلبة هو اكتسابه لجزء من ADN النوع S الموجود ضمن البقايا
استنتاج عام:
الخبر الوراثي يوجد في النواة وهو عبارة عن مادة
الحمض النووي الريبوزي ناقص أكسجين ADN .
دور ADN في تكاثر الحمات(الفيروسات)
ملحوظة: بعض الحمات تتكاثر بفضل
 ARN عوض ADN مثل حمة السيدا(VIH )

ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــ
عن موقع ويب كور

 

Published by دفاتر الاختلاف الالكترونية - dans مدارات علوم الحياة والأرض
commenter cet article
30 septembre 2009 3 30 /09 /septembre /2009 23:18

 

آلية تعبير الخبر الوراثي: مراحل تركيب البروتينات 

 

( وجود عليبة )S مكورات ¬ ADNs + R تذكير: مكورات

إذن هناك علاقة بين الخبر الوراثي و ظهور الصفات.

 

-1 تعريف الصفة:

الصفة هي ميزة نوعية أو كمية تميز فردا عن باقي أفراد نوعه، وهناك صفات ترى بالعين المجردة(لون الأزهار مثلا)

وأخرى تظهر بواسطة اختبارات خاصة(الفصيلة الدموية مثلا).

 

-2 دراسة حالة تغير فجائي في الخبر الوراثي:

 

-1-2 المثال الأول: ظهور المقاومة للستريبتوميسين عند بكتيرية Escherichia Coli

 

عند زرع بكتيرية Escherichia Coli في وسط مقيت ملائم(غراء+ كليكوز+ فيتامينات+أحماض ذهنية في حرارة 37C).

تتشكل مستعمرات بكتيرية تسمى لمات تنتشر فيما بعد ذلك لتشكل كتلة متواصلة على سطح الوسط(بساط بكتيري). لكن عند زرعها في وسط مقيت أضيف إليه Streptomycine الذي يعتبر مضادا حيويا، فإننا نحصل على بعض اللمات فقط على شكل كتل صغيرة مبعثرة على سطح الوسط.

- يتبين من خلال هاتين التجربتين أن البكتيريات التي ماتت بوجود Streptomycine تعتبر حساسة لهذا المضاد الحيوي و يرمز إليها بـ StrepS أما التي بقيت حية تعتبر مقاومة و يرمز إليها بـ StrepR . ظهور هذه الصفة الجديدة تلقائي أي غير محرض و بما أنها انتقلت إلى الأجيال الموالية أثناء تكاثر البكتيريات فهي وراثية أي أن التغيير حدث على مستوى المادة الوراثية ADN نسمي هذا التغيير بالطفرة mutation.

 

-2-2 المثال الثاني: عدم القدرة على العيش في وسط أدنى بدون أرجنين Arg

 

يمكن لبكتيريات Arg- (لا تعيش في وسط أدنى إلا إذا أضيف إليه حمض أميني الأرجنين) أن تظهر انطلاقا من بكتيريات Arg+

وتعطي بكتيريات أخرى Arg- . كما يمكن للبكتيريات Arg- أن تسترجع الصفة المتوحشة و تصبح Arg+ (قادرة على العيش في وسط أدنى بدون أرجنين).

- يمكن تفسير ظهور صفة عدم القدرة على العيش في وسط أدنى دون أرجنين بحدوث تغير على مستوى المادة الوراثية ADN أي طفرة .

- إذن الطفرة هي تغير وراثي و فجائي في انتقال الصفات الوراثية و هذا التغير يمس المادة الوراثية على جزء من ADN الذي يحمل الخبر الوراثي المتعلق بتلك الصفة.

- جزء الـ ADN الذي يحمل الخبر الوراثي المتعلق بصفة معينة يشكل ما يسمى بالمورثة gene. وكل مورثة توجد بنسخة واحدة على صبغي معين و مكانها يسمى موضع المورثة Locus ، كما يمكنها أن توجد على عدة أشكال تسمى الحليلات alleles فمثلا StrepR و StrepS حليلين لنفس المورثة (العلاقة مع المضاد الحيوي Streptomycine فالحليل StrepS متوحش (الأصل) و الحليل StrepR طافر.

- يمكن أن تكون الطفرة تلقائية أو محدثة بعوامل فيزيائية(أشعة) أو كيميائية(مواد كيميائية) أو بيولوجية(فيروسية) ، و هناك عدة أنواع من الطفرات :

ـ طفرة عن طريق ضياع نيكليوتيد.

ـ طفرة عن طريق إضافة نيكليوتيد.

ـ طفرة عن طريق استبدال نيكليوتيد بنيكليوتيد آخر.

ـ طفرة عن طريق تغير ترتيب النيكليوتيدات...

 

 

-3 الدلالة الوراثية للطفرة:

 

تمثل الأمثلة التالية مقارنة بين الأفراد الطافرة و الأفراد المتوحشة:

المثال الأول: الفرق بين الفئران المتوحشة الرمادية و الفئران الطافرة البيضاء هو أن الأولى تتوفر على صبغة الميلانين(تركبها انطلاقا من التيروزين بوجود أنزيم بروتيني) و الثانية لا تتوفر على صبغة الميلانين(غير قادرة على تركيبها نظرا لعدم توفرها على الأنزيم).

 

 

صفة اللون عند الفئران مرتبطة إذن بنشاط بروتين(أنزيم) .

المثال الثاني: الخضاب الدموي بروتين يوجد داخل الكريات الحمراء و له دورين ، وظيفي يتجلى في نقل الغازات التنفسية و بنيوي يتجلى في إعطاء الشكل الكروي المقعر للكريات الحمراء. ينتج فقر الدم المنجلي عن تركيب خضاب دموي Hemoglobine غير عادي (تشوه الكريات الحمراء تصبح منجلية الشكل) و يرمز له بـ HbS عوض HbA .

 



كريات حمراء منجلية الشكل




تبين الوثيقة الموالية مقارنة بين جزء من الخضاب HbA و الخضاب HbS

 

 

 

لا تختلف جزيئة HbS عن HbA إلا باستبدال الحمض الأميني 6 رقم GLU بـ VAL.

إذن فشكل الكريات الحمراء(الصفة) مرتبط بطبيعة الخضاب الدموي(البروتين) .

أي أن هناك علاقة بين الصفة و البروتين. فالصفة تترجم بوجود بروتين بنيوي أو وظيفي .

و سبق أن كشفنا عن وجود علاقة بين الصفة و الخبر الوراثي . فما هي طبيعة العلاقة بين الخبر الوراثي و البروتين؟

للإجابة عن هذا التساؤل نقترح دراسة الخبر الوراثي المسئول عن تركيب الخضاب الدموي.

يمثل الشكلان 1 و2 على التوالي جزء من المورثة HbS و جزء من المورثة HbA.

 

الشكل 1

الشكل 2

 

 

 

 

 

 

 

 

 

 

 

 

ـ مقارنة: هناك تشابه في جميع القواعد الأزوتية باستثناء القاعدة T رقم 17 في ADN المتحكم في تركيب HbA و التي عوضت بالقاعدة A في ADN المتحكم في تركيب HbS ، إذن حدثت طفرة .

- استبدال T بـ A على مستوى المورثة أدى إلى استبدال الحمض الأميني GLU بـ VAL على مستوى البروتين و بالتالي تحول HbA إلى HbS الذي أدى الى تغير شكل الكريات الحمراء(الصفة).

ـ إذن هناك علاقة بين المورثة و البروتين: ترتيب النيكليوتيدات في ADN هو الذي يحدد طبيعة و ترتيب الأحماض الأمينية في البروتين.

 

-4 كيف تترجم العلاقة مورثة - بروتين؟

 

إن تعاقب الأحماض الأمينية يحدد خصوصية البروتينات، و بما أن مصدر البروتين هو المورثة أي ADN فيقتضي الأول وجود طابع وراثي معين ADN الذي يمتاز كذلك بمتتالية. لنسم وحدة رمزية مجموعة النيكليوتيدات القادرة على الإشارة إلى حمض أميني(aa لكل حمض أميني وحدة رمزية نوعية و بالتالي يجب أن تتواجد 20 وحدة

رمزية مختلفة، المشكل المطروح هو كيف يمكن انطلاقا من النيكليوتيدات الأربعة الإشارة إلى 20 حمض أميني.

فرضية 1: وحدة رمزية = نيكليوتيد واحد ← لن يوجد إلا 4 وحدات رمزية و هذاغير كافي.

فرضية 2: وحدة رمزية = نيكليوتيدان متتاليان ← لن يوجد إلا .16 وحدات رمزية و هذاغير كافي.

فرضية 3 : وحدة رمزية = 3 نيكليوتيدات متتالية ← سنحصل على 64 وحدات رمزية و هذا أكثر مما هو لازم للاشارة لـ 20 حمض أميني.

نجد عدة وحدات رمزية ترمز لحمض أميني واحد وبعضها لا يشير لأي حمض أميني( نقول أنها بدون معنى) و تكون لائحة الوحدات الرمزية و الأحماض الأمينية

المناسبة لها الرمز الوراثي Le code génétique

 

-5 من الرمز الوراثي إلى بروتين.

 

تذكير: يتم تركيب البروتينات على مستوى السيتوبلاسم تحت إشراف المورثات(ADN) الموجودة في النواة.

إذن كيف تصل الإشارات من النواة إلى السيتوبلاسم لتركيب البروتينات.

 

-1-5 تجربة Paul et Goldstein:

 

 

قام العالمان بوضع أميبة في وسط مشع 1 و بعد أن أصبح الإشعاع في النواة 2 وضعت هذه الأخيرة داخل أميبة عادية منزوعة النواة 3 لوحظ أن الإشعاع انتشر إلى السيتوبلاسم 4 .

هذا يوحي بخروج مواد من النواة إلى السيتوبلاسم.

- إذا أخضعنا الأميبة المطعمة بالنواة لتأثير أنزيمات هاضمة لحمض نووي ARN تتوقف النشاطات الخلوية.

إذن المواد التي تخرج من النواة إلى السيتوبلاسم عبارة عن حمض نووي ريبوزي ARN .

 

 

تساؤل:ما هي العلاقة بين ADN و ARN ؟

تبين الوثيقة التالية كيفية انتقال الطابع الوراثي من ADN إلى ARN أي النسخ الوراثي Transcription بعد ذلك ينتقل الخبر الناتج عن نسخ المورثة إلى السيتوبلاسم على شكل رسول نرمز له بـ ARNm .

ARNm 3

4 ARN بوليمراز

1 لولب مستنسخ

2 لولب غبر مستنسخ


يعمل أنزيم ARN بوليمراز على تفريق لولبي ADN في مقدمة المورثة المراد نسخها، ثم يشرف على إدماج النيكليوتيدات الحرة حسب تكامل القواعد الأزوتية، وعندما يصل إلى نهاية المورثة يتم تحرير ARN بوليمراز و ARNm.

ملحوظة: تنتقل عدة جزيئات الأنزيم من موقع بداية الاستنساخ إلى نهايته و هكذا يتم نسخ عدة جزيئات ARNm في آن واحد.

 

-4-5دور ARNmفي تركيب البروتينات:

 

أ – تجربة و نتيجة: نحضر خلاصة بكتيريات تحتوي على كل المكونات السيتوبلاسمية لكن ينعدم فيها ADN و ARN ، بعد ذلك تضاف إليها أحماض أمينية و ARNذائب مستخلص من السيتوبلاسم.

<!--[if !mso]--><!--[endif]--><!--[if !mso]--><!--[endif]--><!--[if !mso]--> <!--[endif]-->

ويمثل المبيان التالي النتائج المحصل:

 

 

 

 

ب – تحليل واستنتاج: نلاحظ أنه بعد كل حقن لـ ARN يرتفع عدد الأحماض الأمينية المدمجة في البروتينات، أي أن ARN هو المسئول عن دمج الأحماض الأمينية في البروتينات .

 

 

-5-5 تركيب البروتينات:

 

أ – الكشف عن الرمز الوراثي:

 

* تجربة Nirenberg:

 

 

توصل هذا العالم إلى مفهوم الرمز الوراثي أي أن كل ثلاثية نيكليوتيدية ترمز إلى حمض أميني معين و تشكل بذلك وحدة رمزية.

هناك 61 وحدة رمزية من بين 64 الممكنة ترمز كل منها إلى حمض أميني و هنا تبرز ظاهرة التكرار حيث يرمز إلى حمض أميني بعدة وحدات رمزية.

ثلاث وحدات رمزية تشير إلى نهاية التركيب البروتيني و تسمى وحدات قف أو بدون معنى أي أنها لا تشير إلى أي حمض أميني . UAA-UAG-UGA

 

 

 

الرمز الوراثي Le code genetique

 
 

ب – العوامل الأخرى المتدخلة في تركيب البروتينات:

 

* معطيات تجريبية: تبين تجارب استعمال الأحماض الأمينية الموسومة بالكربون المشع 14C أن اندماجها على مستوى البروتينات يتم على مستوى تركيبات خاصة تسمى البوليزومات و هي ملتصقة بالشبكة السيتوبلاسمية الداخلية، إذا عالجنا البوليزوم بأنزيم ARNase يتم تفكيكه إلى ريبوزومات.

* إذن يحتاج تركيب البروتينات إلى ريبوزومات .

* الريبوزومات عضيات سيتوبلاسمية صغيرة يتشكل كل واحد منها من وحدة صغيرة و وحدة كبيرة، وتتكون كل وحدة من ARN ريبوزومي (ARNr) و من بروتينات سيتوبلاسمية.

* يحتاج تركيب البروتينات أيضا ARN ناقل (ARNt) الموجود بالسيتوبلاسم، ويختص بنقل الأحماض الأمينية الحرة حسب طبيعة مضاد الوحدة الرمزية الموجود أسفل ARNt.

 

بعض الأحماض الأمينية

ARNt

ريبوزوم

ARNm

الأحماض الأمينية1

 

1 موقع تثبيت الحمض الأميني

2 مضاد الوحدة الرمزية

1 وحدة ريبوزومية كبيرة

2 وحدة ريبوزومية صغيرة

 
 

ج – مراحل تركيب البروتينات:

 

تشمل عملية تركيب البروتينات ثلاث مراحل:

* المرحلة الأولى:.البداية

- تثبيت الوحدة الريبوزومية الصغرى على ARNm الذي تكون وحدته الرمزية الأولى AUG .

- وصول ARNt حاملا معه حمض أميني Met .

- تثبيت الوحدة الريبوزومية الكبرى و بداية عمل الريبوزوم.

* المرحلة الثانية:الاستطالة

- وصول ARNt آخر حاملا معه حمض أميني مطابق للوحدة الرمزية الموالية .

- تشكل رابطة بيبتيدية بين Met و الحمض الأميني الموالي و انشطار الرابطة بين Met و ARNt الذي يغادر الريبوزوم (وجود طاقة ATP )

- يتحرك الريبوزوم بوحدة رمزية واحدة و هكذا تتضاعف الأحماض الأمينية في السلسلة البيبتيدية.

* المرحلة الثالثة:النهاية

- عندما يصل الريبوزوم إلى الوحدة الرمزية(UAA أو UAG أو UGA ) وهي بدون معنى أي أنها لا تشير إلى أي حمض أميني يتوقف تركيب البروتين و هي تسمى بذلك وحدات قف .

- تفترق وحدتي الريبوزوم عن بعضهما البعض و عن ARNm و يتم تحرير السلسلة البيبتيدية.

- ينفصل الحمض الأميني Met عن باقي السلسلة البيبتيدية .

ملحوظة: تتم ترجمة جزيئة ARNm عدة مرات من طرف مجموعة من الريبوزومات لكن بتأخير زمني وهذا ما يفسر تركيب عدة جزيئات من نفس البروتين.

 

 

 


Published by دفاتر الاختلاف الالكترونية - dans مدارات علوم الحياة والأرض
commenter cet article

صحافة إلكترونية

  • : مجلة دفاتر الاختلاف الإلكترونية
  • مجلة دفاتر الاختلاف الإلكترونية
  • : مجلة دفاتر الاختلاف الإلكترونية -مجلة مغربية ثقافية شاملة -رخصة الصحافة رقم:07\2005 - ردمد: 4667-2028
  • Contact

موسيقى

بحث

أعداد المجلة الشهرية